overlap extension and clone gene into pET -15b - a question?? (Jun/28/2005 )
Hello,
I have a theoretical question. I have such a gene, which is already cloned into pcDNA3.1+ plasmid:
GCTAGCGTTTAACTTAAGCTTGGTACCATC atg cca gta atc aat..........gtg aca ctg gaa aga (atg) cta gtt tcc aaa tgt tgt ..............ggc tgt gtg att tca taa CTCGAGTCTAGAGGGCCC
I have to change (atg) into (gag) and then I have to clone this gene into pET-15b plasmid, which sequence you can see by clicking in this link:
https://www.theses.ulaval.ca/2004/21738/21738027.png
and I have a question: if I clone my gen into this gene using NdeI and XhoI restriction sites what product I receive?? I want to know which stop codon woul be recognised ( in my gene or in plasmid??). I have one more question what for is a sequence for thrombin there?? Is it needed for purification??
Thank you in advance for every answer,
Kasia
where is you ndeI site on your fragment?
Hi Kasia,
Like Fred I couldn't see your Nde1 site in the sequence you submitted. Anyway you have to make sure that your open reading frame is consistent with the open reading frame of your expression vector, or else you won't get your protein of interest.
The thrombin site is a cleavage site, which you can use to remove the His tag off the N-terminus for purification purposes. Depending on the purpose of your expression you may want to remove the His tag.
Cheers,
Scott
Like Fred I couldn't see your Nde1 site in the sequence you submitted. Anyway you have to make sure that your open reading frame is consistent with the open reading frame of your expression vector, or else you won't get your protein of interest.
The thrombin site is a cleavage site, which you can use to remove the His tag off the N-terminus for purification purposes. Depending on the purpose of your expression you may want to remove the His tag.
Cheers,
Scott
Thank you very much for your answer.
The sequence for Nde1 I have put in 1th primer 5' CTAGCATATGatg cca gta atc aat att.......3'
and the sequence for end primer is: 3' ccg aca cac taa agt att GAGCTCCTGA 5'
I.m not sure if the primers are good and if they would not change ORF. I am very begginer in this area. I would be very grateful if you could tell me if I am doing right. So as I understood the stop codon in my gene is the one that is recognised as stop?? Is it not too far from T7 terminator??
Best regards,
Kasia