Protocol Online logo
Top : Forum Archives: : Molecular Biology

PCR with T7 promoter/T7 terminator - (May/19/2005 )

Dear all:
I'm just wondering if it's possible to perform PCR, once my cDNA fragment is inserted into Novagen's pET series vectors, using the above T7 pro/T7 term. as primers since their respective GC% and Tm are fairly low? Is any one of you had prior successful experience with this, could you kindly provide your PCR settings as well? Many many thanks in advance!!

-bhchen66-

if the vector contains the primer sequences I can't see it being a problem, we use pGEM and the T7 promoter primer for DNA sequencing and that works perfectly, so PCR shouldn't be a problem at all.

nick

-methylnick-

QUOTE (methylnick @ May 20 2005, 11:04 AM)
if the vector contains the primer sequences I can't see it being a problem, we use pGEM and the T7 promoter primer for DNA sequencing and that works perfectly, so PCR shouldn't be a problem at all.

nick


Hi, Nick:
Thanks for your reply. Yes, the vector we're using (pET24.1) does have those two primer sequences. However, would you suggest as how I should do with the PCR setting? Tm and GC% for those primers are around 38C and 40%, respectively. Would this be a problem for regular Taq-based PCR? Thanks again.

-bhchen66-

hi again,

with regard to the Tm calculations, there are different formulas and ways to calculate the Tm, some formulas take into account ion concentrations and the like.

our T7 primer works well with a Tm within the PCR set at 50C and it works very well for seqeuncing. I can't see your primers being a problem, just have to try it.

could you post the primer seqeunces so we call all have a look at this?

Nick

-methylnick-

Hi, Nick:

Here are sequences for both of them.

T7 promoter: TAATACGACTCACTATAGGG
T7 terminator: TATGCTAGTTATTGCTCAG

I'm also attaching the sequence analysis results using VNTI for your reference. Thanks again.

-bhchen66-

That is interesting with vector NTI,

I use a fellow colleagues program called perlprimer this is available at https://perlprimer.sourceforge.net

here is the screen shot for your primers....they are well above 50C

so I would say they are okay for PCR

good luck!!

Nick cool.gif

-methylnick-