This is a cached page for the URL (http://www.stewartlab.wustl.edu/trap_assay.htm). To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content.
About Cache
Creation and use of your infectious vector

Stewart Laboratory Standard Operating Procedure               

TRAP Assay

A. Prepare lysate

Lyse cells for 20-30’ on ice in CHAPS lysis buffer.

Spin cells at 4°C for 20’

Save supernatant in a new Rnase-free tube.

Quantitate protein concentration using the Lowry protocol. Be sure to have appropriate blanks and concentration controls.

Dilute a small portion of the sample to 50 ng/μl. Return the undiluted sample to -70°C for future use.

Take one quarter of the diluted sample and boil for 5’ and crash on ice. This will serve as your heat inactivated control.

B. End label TS oligo:

Label as follows (this makes enough oligo for 10 reactions):

2.5 μl g32P ATP (3000 Ci/mmol)

2 μl 10X buffer

5.2 μl TS primer

9.8 μl ddH2O

0.5 μl T4 kinase

o Heat to 37°C for 20’

o Heat to 85°C for 5’

C. Set-up TRAP reaction:

Set-up the following 50 μl reaction (this is per reaction so when performing multiply reactions prepare a supermix). Each sample should have a minimum of two conditions, the sample and the heat inactivated control. You can also set-up a dilution series if you are attempting to quantitate the activity:

5 μl 10X buffer

2 μl Primer

2 μl labeled TS primer

1 μl dNTPs (at 2.5 mM each)

0.4 μl Taq

37.6 μl ddH2O

2 μl prepared extract

D. Run reaction

Set up PCR machine as follows:

30’ at 30°C

27 cycles with the following:

94°C for 30”

60°C for 30”

E. Run gel:

12.5% acrylamide gel (0.4mm) with 0.5X TBE buffer

add 10 μl of 6X loading dye and run 6 μl

run gel at about 1000-1200 volts until the first dye runs off and the second dye is about 3/4 the way into the gel.

Important buffers:

1X CHAPS (3-[(Cholamidopropyl)dimethylammonio]-1-propanesulfonate) buffer (All Rnase-free)

10 mM Tris, pH 7.5

1 mM MgCl2

1 mM EGTA

0.1 mM benzamidine

5 mM 2-mercaptoethanol

0.5% CHAPS

10% glycerol

o Immediately before lysing cells add 5 mM -mercaptoethanol (stock from Sigma is at 14.3 M so add 0.5 μl to 1.4 mls of the buffer)

10X TRAP buffer

200 mM Tris, pH 8.3

15 mM MgCl2

630 mM KCl

0.5% Tween 20

10 mM EGTA

0.1% BSA

50X dNTPs

2.5 mM of each dNTP

Oligos:

ACX GCGCGGCTTACCCTTACCCTTACCCTAACC

TSNT AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT

NT ATCGCTTCTCGGCCTTTT

TS AATCCGTCGAGCAGAGTT

Oligos ordered purified in solution

Concentrations for use:

Primer mix II

ACX 0.1 μg/sample

NT 0.01 μg/sample

TSNT 0.01 amol/sample

Primer mix III

ACX 0.1 μg/sample

NT 0.1 ng/sample

TSNT 0.01 amol/sample