cloning of PCR product - (Sep/30/2005 )

Hi,
I wanted to clone a PCR product of 512 bp with pBluescript (3kb). I first made the amplified product blunt by using T4 DNA polymerase and then used for ligation in the ratio of 1:10. Vector was digested with sma1 and dephosphorylation was not done.Insert and digested vector were purified and ligation was done with 5 units of Fermentas T4 DNA Ligase in 50ul reaction But after ligation when I checked on gel I could not see ligated band. Rather I saw separate bands of vector and isert itself. I did IPTG X-gal screening also but got only blue colonies . Because my insert is RT-PCR product of inducible gene so I can not afford to waste my sample because already sample is too less.So any suggestion will be highly appreciated.

I'd advise you to re-make the primers with a suitable restriction site engineered into the 5' ends -- blunt ending is always (in my hands, anyway) an iffy proposition. Be sure to add a few bases (2 to 4 usually works fine for most enzymes) 5' of the restriction site. Re-run the PCR, clean it up with a PCR clean-up kit (we use Qiagen's), digest it, gel purify it, and ligate that with your vector. I suggest strongly that you dephosphorylate the digested vector, and gel purify it as well.

So, for example, if my primers were ATCTTATGCATTACGTAGCG and CTAGCTAGCTTAGCATGAGC, and I wanted Sma I ends, I would have synthesized:

GCGACCCGGGATCTTATGCATTACGTAGCG
CGAGCCCGGGCTAGCTAGCTTAGCATGAGC

The irrelevant 5' bases are bold (I usually add whatever number of bases I need by duplicating the 3' end of the primer backwards -- it's just a habit, but it'll insure the primers won't fold back on themselves), the restriction sites are underlined.

We do this routinely (like every day) in our lab...

How did you do the ligation (time/temp)?