Primers for species identification - Know any good? (May/11/2005 )

Hi!

I'm looking for primers for molecular identification of the following species:

Sphaerotilus natans
Haliscomenobacter hydrossis
Thiotrix
Nocardia

Does anyone know any good primers for doing this? Or any tips on where to start?

I've previosly made my own primers, but then I was looking for a particular toxin gene, not a specific bacteria...

//jk

---

If you are using sequencing, 16s rDNA typing is considered a good method of identifying different bacteria (18s for fungi) down to the species level.

However, while some sequenced the 16S ribosomal RNA gene. My lab sequenced the intergenic region between the 16s-5.8s-23s rDNA region. We used the conserved regions within the 16s and 23s region to design primers to PCR the region between the two genes and then sequenced the pcr product. We were able to use the same primers for multiple genus and with all the heterogenity in the intergenic region we were able to look at smaller sequences and type to the genus, species and sometime strain level.

---

Why dont you try a simple primer extension assay and assay for a combination of SNPs?

---

hi,
we have a primer for the hsp65 of actinomycetes that work very well for Mycobacterium sp., Nocardia and Tsukamurella (our experience!), so if you want I'll give you the seq.
which region do you want amplify?

---

That would be great!

I'm not looking for any specific regions, I only want to confirm their prescence/abscence in my samples.

---

TB11: ACCACCGATGGTGTGTCCAT (FORWARD)
TB12: CTTGTCGAACCGCATACCCT (REVERSE)

these work well with my organisms

:P

ciao

---

Thanx!

---