Protocol Online logo
Top : Forum Archives: : Molecular Biology

Optimum annealing temperature were fail with no band and just smearing - Optimum annealing temperature were fail with no band and just smearing (Jul/24/2008 )

Pages: Previous 1 2 

Hi!

You can try my program:

http://www.snowflake-sl.info/labtools_eng.htm

You can choose different methods and adjust all conditions!

Regards
Stefanie

-stefanie-

I would suggest that you try PCR with different primers on your template to make sure that it really isn't your template that is the problem. And replace all of your buffers, dNTPs, water etc just in case you have some nuclease or PCR inhibitor contamination.

Oh, and like swanny asked, could you tell us your PCR cycle parameters- this could help us make some more suggestions.

-lauralee-

hi all , thank for giving me support and advice.
today i run a sample and I'll describe more detail

the size of product should be 306 bp, and i run protocol of PCR gradient as picture below:



today i run again using some modification concentration as below:



and the result as below under 1% agraose gel



-----------------------------------------------------------------------------------------

-lazyyan-

QUOTE (lauralee @ Jul 29 2008, 01:05 AM)
I would suggest that you try PCR with different primers on your template to make sure that it really isn't your template that is the problem. And replace all of your buffers, dNTPs, water etc just in case you have some nuclease or PCR inhibitor contamination.

Oh, and like swanny asked, could you tell us your PCR cycle parameters- this could help us make some more suggestions.


i have extra primers ; commercial primers

which is forward - 5' AAA AAG CTT CCA TCC AAC ATC TCA GCA TGA AA 3'

and reverse 5' AAA CTG CAG CAG CCC AGA ATG ATA TTT GTC CTC A 3'

conclusion: I'll try for the next day with commercial primers and new taq, buffer and etc including TBE, the result I'll post here

-lazyyan-

QUOTE (swanny @ Jul 28 2008, 08:57 PM)
QUOTE (lazyyan @ Jul 28 2008, 09:50 PM)
hi chatter n admin,

my primers that's i'm using is:

Foword = 5'-ttt ggc tct ctt tta gga ct-3'

which is 4 (G+C) + 2(A+T) = 52

and;

Reserve = 5'-tag acc gta ccc tac gaa c-3'

which is 4 (G+C) + 2(A+T) = 56

today i change the concentration of pcr product as describe below:

1x time;

DNA = 3ul
Primer-F = 1 ul
primer-R = 1 ul
Mgcl = 1.5
taq = 0.5
buffer A = 2.5
dntp = 2.5
sdh20 = 8

result: the result still just have a smear,

i don't why.. please give me some advice or ideas

I think your primers are a bit short. Try adding a few bases to give a Tm of 60-65 C. That should reduce the problem of non-specific binding.

Re MgCl2; you might have to do a titration experiment. Go from 0.5 mM to 5 mM and see what happens.

PCR parameters: how big is the product? How long is the extension time?


conclusion: i have redone my renew primers design which is long than b4 but still waiting the new primers



do u think that's primers is more stable than before?

-lazyyan-

OK, thanks for sending the gel. It confirms what I said before: the original primers are too short. The new ones you have ordered should work much better. Point to note: using the back-of-an-envelope calculation (4x(G+C) + 2x(A+T)), I calculated the Tms to be higher than what your software calculated them to be (66 and 68). If you want to try a gradient run again, I'd suggest you go between 60 and 55, but at that lower end the efficiency will be lower, because Taq is not very active below 65C.

-swanny-

QUOTE (swanny @ Jul 29 2008, 03:17 PM)
OK, thanks for sending the gel. It confirms what I said before: the original primers are too short. The new ones you have ordered should work much better. Point to note: using the back-of-an-envelope calculation (4x(G+C) + 2x(A+T)), I calculated the Tms to be higher than what your software calculated them to be (66 and 68). If you want to try a gradient run again, I'd suggest you go between 60 and 55, but at that lower end the efficiency will be lower, because Taq is not very active below 65C.


thank swanny..

today i try run commercial primers and my designed primes,

and the result with commercial primers was perfect but my own design primers don't show band just smear.. ya I'll wait until new primers arrived, ill try with the same concentration that's i test on commercial primers.

-lazyyan-

hi admin and chatter,
today i run new primer with same concentration i'm using for commercial primer,

my new primer


and my commercial primer,

which is forward - 5' AAA AAG CTT CCA TCC AAC ATC TCA GCA TGA AA 3'

and reverse 5' AAA CTG CAG CAG CCC AGA ATG ATA TTT GTC CTC A 3'

1. i'm using same concentration for both primer above and my new primer don't show band and just smearing, meanwhile my commercial primer show band. i run annealing 55 to 65.

2. so i'm think might be my primer design was wrong

3. how do i design my primers?

first i'm do the search in NCBI and search for keyword "channa striata"
and found Nucleotide. because i'm using mtDNA cyto B, then i select

>gi|2564486|gb|AF012789.1|AF012789 Channa striata STR1 cytochrome b (cytb) gene, mitochondrial gene encoding mitochondrial protein, partial cds
TTTGGCTCTCTTTTAGGACTCTGCTTAATTACACAAATCCTCACAGGGCTATTTCTTGCTATACATTACA
CATCAGACATTTCTACCGCCTTCTCATCCGTGGCACACATTTGCCGAGACGTAAACTATGGATGACTAAT
TCGTAACCTCCACGCCAACGGCGCCTCATTTTTCTTTATTTGTATTTATTTCCACATCGGCCGAGGCCTA
TACTACGGCTCCTACCTCTATAAAGAGACATGAAATGTCGGCGTAATACTACTGCTACTAGTGATGATGA
CGGCGTTCGTAGGGTACGTTCTACCC

then for easy step my using http://tools.invitrogen.com/content.cfm?pageID=9716; and put the fasta format.
and the result coming up and send to order the primers.


-lazyyan-

any one? swanny?

-lazyyan-

Pages: Previous 1 2