primer design problems - (Oct/15/2006 )
hello,
I designed some primers and when I ordered them I made a stupid mistake switching two nucleotides. I didn't realize untill after I cloned and transformed the product of amplification.
The frame is the same but for the  9th amino acid insteed of GC switched to CG.
5' TCATGCTACGGCGGAGTCAAGGATCGTGGGCT 3'
Do you think this will affect the function of the protein produced from this gene?
thank you
-richard_70-
QUOTE (richard_70 @ Oct 16 2006, 04:01 PM) 
hello,
I designed some primers and when I ordered them I made a stupid mistake switching two nucleotides. I didn't realize untill after I cloned and transformed the product of amplification.
The frame is the same but for the 9th amino acid insteed of GC switched to CG.
5' TCATGCTACGGCGGAGTCAAGGATCGTGGGCT 3'
Do you think this will affect the function of the protein produced from this gene?
thank you
I designed some primers and when I ordered them I made a stupid mistake switching two nucleotides. I didn't realize untill after I cloned and transformed the product of amplification.
The frame is the same but for the 9th amino acid insteed of GC switched to CG.
5' TCATGCTACGGCGGAGTCAAGGATCGTGGGCT 3'
Do you think this will affect the function of the protein produced from this gene?
thank you
It all depends on the frame. Check it out for yourself, and see if you get different amino acids.
-swanny-
QUOTE (swanny @ Oct 15 2006, 11:41 PM) 
QUOTE (richard_70 @ Oct 16 2006, 04:01 PM) 
hello,
I designed some primers and when I ordered them I made a stupid mistake switching two nucleotides. I didn't realize untill after I cloned and transformed the product of amplification.
The frame is the same but for the 9th amino acid insteed of GC switched to CG.
5' TCATGCTACGGCGGAGTCAAGGATCGTGGGCT 3'
Do you think this will affect the function of the protein produced from this gene?
thank you
It all depends on the frame. Check it out for yourself, and see if you get different amino acids.
I already checked and the aminoacid is changed. The changed aminoacid is the 9th from the end of the gene. Will this affect the function of the encoded protein?
-richard_70-
which aminoacid is the original one? and into which aa it was turned?
-dodosko-
My reply is: Buy a new primer!!!!!!!!!!!!!!!!!  
M.
-zealotto-
