Another name of IkappaBalpha? - (May/17/2006 )
Hello!
I need some help. I must design new primers for Real Time-PCR but I do not find anywhere the sequence of IkappaBalpha.
I have test a primer from the litterature but it doesn't good work.
Anyone have got an idea, perhaps another name of IkappaB_alpha ?
Thanks a lot!
Elodie
hi,
you should find some good informations with the query "ikappab alpha" on SRS (select EMBL and GENBANK)
http://www.infobiogen.fr/srs71bin/cgi-bin/...rsq2+-noSession
enjoy!
PS: IkBa is also known as "NF-kB inhibitor alpha"
I used the new design tool from Roche, it took less than 1min.
You can try to run it without the LNA Probe.
https://www.roche-applied-science.com/sis/rtpcr/upl/adc.jsp
ProbeFinder has designed the optimal real-time PCR assay for:
ENST00000216797.2 NFKBIA HUGO NF-kappaB inhibitor alpha (Major histocompatibility complex enhancer- binding protein MAD3) (I-kappa-B-alpha) (IkappaBalpha) (IKB-alpha). [Source:Uniprot/SWISSPROT;Acc:P25963]
You can increase sensitivity and obtain optimal performance of your qPCR assays by using the FastStart TaqMan® ProbeMaster on any block-based real-time PCR instrument.
Assay details:
Use Universal ProbeLibrary probe: #38, cat.no. 04687965001
(Formerly Exiqon ProbeLibrary probe: Human#38)
Primer Length Position Tm %GC Sequence
Left Primer 20 238 - 257 59 55 gtcaaggagctgcaggagat
Right Primer 18 331 - 348 60 56 gatggccaagtgcaggaa
Amplicon (111 nt)