How to determine the DNA methylation of the whole gene - Primer design for BSP (Jan/25/2006 )
Hi all,
I would like to introduce my research at a glance at first. I am working on graft transmission of RNA silencing in trasngenic N. benthamiana. I have analyzed the induction of trasnsitive RNA silencing in the non silenced plants by the silenced ones. Now my job is to check the DNA methylation status of the trasngene in my plants. My plants carry the trasnsgene of nearly 1.2 kb. Can anybody give give some idea how to proceed this exp? 
My strategy is to design 3 pairs of primer covering 400bp each, in this way I can sequence the whole gene (Bisulfite sequencing). But the problem is that the gene carries CpG at the start region, how can I resolve this problem to design primers. 
I am in the second year of PhD, and time is running out...........please help.
Regards,
Nazmul
I think the only way to deal with those CpGs is to design degenerate primers for the Cs with unknown methylation status, but I have not done this.
I agree with cristi that degenerate primers may solve your problem. How about area outside that CpG-rich region?
Hi pcrman and cristi,
thanks for your comments, I was also thinking in this track. But problem is the designing of primers, I have no experience of it , so studiying on this, comments in this regard will be  very helpful. I have tried methprimer and primo MSP 3.4 to design primers (Perlprimer can not be used for plants, am I right?). I could not design primers to amplify desired sequence by Methprimer, but Primo could solve the problem. I found ail the desined primers carry one or two degenerate nucleotides, means I will not be able to determine the methylation status of that CpG, can I avoid this? I am sending the whole sequence:
atccttcgcaagacccttcctctatataaggaagttcatttcatttggagagaacacgggggactctagatctagtgaac
gtactgaattcaaagatgcgggagcgaaccctccagcccctaagcctcagaatatccctccaccacccacaataactgagg
ttactgatccagaagacccaaagcaggcagctttgagagctgcacgagctaagcaacccgcaaccattccagaatcatatg
gacgagacactagcaaggagaaggaatcaatagtgggggcatcatcaaagggtgcgagggataaagatgtaaacgttggaa
cagttggtacgtttgtcgtgccacgtgttaagatgaatgcaaacaagaaaaggcaaccaatggtaaatggaagggccatta
taaatttccaacacttgtcaacatatgagccagaacagtttgaggttgcaaacacccggtcgactcaagaacagtttcaag
catggtatgagggagtgaaaggggactatggtgttgacgatacaggaatggggatcttattgaatggattaatggtttggt
gcattgaaaatggcacatccccaaatataaatggcgtgtggactatgatggatggtgatgagcaagtgacatatccaatta
aaccattgttggaccatgcagtgcctacttttaggcagattatgacgcacttcagtgacgttgctgaagcttacatagaaa
tgcgaaaccgtacaaaggcgtacatgccgaggtatggtctacaacgtaatttgactgatatgagtcttgcgcgatatgcat
ttgatttctacgagctgcattcaaccacccctgcacgtgcaaaagaagcacatttacagatgaaggcagccgcgcttaaga
atgcgaaaaatcggttgtttggtttggacggaaacgtctccacgcaagaagaagatacggagaggcacacgacaactgatg
ttactagaaatatacataacctcttaggaatgaggggtgtgcaataggacatcctctgcactgtagtttatacttatgtta
tctttagtatgcctttaatttaaattcgtgtctttcagtcccgaaggagatggttgagtgcataacatggtgggattatat
ctcggttattgcatttgagaagtcgcctttctattacgtatcataagggactcttaaaagtgaggagtacctcgtaagaaa
agcctttttggttcgtgatcgagccaatttccccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgt
tgccggtcttgcgatga
1-70: promoter seq. (Partial)
71-1239: CP gene (I need to check the methylation status of this gene)
1240-1312: Terminator seq.  (Partial)
CgP island: 825-926
My strategy is to design 3 pairs of primers in a way that 3 amplicons cover my target seq (71-1239), and then clone and sequence.  Is my strategy ok? or it can be done in a better way? God knows.....or the experienced guys of this forum knows..............
Can anybody suggest me any kit for the bisulfite treatment of the genomic DNA (plant)? Does kits give better result?
actually in this region, CpGs are not with high density, and don't get any CpG island. It is easy to design BSG primers in this region. For modification, you can try ZYMO product, it works very good in my hands. good luck
Hi Nazmul,
Your sequence is not very CpG rich and should has places for picking BSP primers (without CpGs) at both ends and in the middle.
Thanks pcrman and lambo. I tried Primo MSP 3.4 for primer designing, but all the primers carried at least 1 degenerate nucleotide. Will I design primers manually to avoid CpG?
Hi Nazmul,
You can pick your primers manually by following the general rules of designing primers for bisulfite modified DNA. Three very basic rules must be followed. 1) Primers should be longer (25-30) than regular PCR; 2) contain enough non-CpG 'C's; 3) contain no CpG sites.
Good luck.
Hi pcrman,
I have designed primers according to your suggestion, these are given below:
Set 1: 						   Position          Tm
Forward	    AAGTTTATTTTATTTGGAGAGAATA	                           32-56	    51.5 
Reverse	    ATACCATACTTAAAACTATTCTTAA	                           469-493	    50.5
 
Set 2:
Forward	    TTAGAATAGTTTGAGGTTGTAAATA	                         434-458	    52.7
Reverse	    TCATCTATAAATATACTTCTTTTAC	                         848-872	    48.8 
Set 3:
Forward	    AAAGAAGTATATTTATAGATGAAGG                                          851-875	    50.9
Reverse	    AAAAACTTTATTACCAAATATTTAA	                     1255-1279	    48.8  	
What is your comment on these primers?
