unexpected band in PCR with plasmid - (Jan/10/2013 )

hi
i have designed a set of primers for checking cloning in the plasmid pET28b. Though the primers are not expected to bring out any band with empty plasmid, it shows a band around 100bp which is also observed in the transformant plasmid. the primer sequences are:PET F- ATTCGGATCCACTAGTTATTG PET R- AATTCCCCTCTAGACCCTTGA. can anyone pls refer any online tool to get the sequence of the amplicons on submitting the template and primers.
Indhu

It is most likely just primer dimer, could you post a gel photo?

Your primers both have fairly long strings of homology with the pET28b sequence. If you compare the pET28b sequence with the forward primer sequence using clustal you will see perfect base paring of 10 bases. Similarly if you compare the pET28b sequence to the reverse complement of the reverse primer you see perfect base paring of 14 bases.

Then if you do a primer blast (http://www.ncbi.nlm....s/primer-blast/) using just the perfect base paring parts of the primers, you get a product of 154bps.

Primer pair 1
Forward primer ATTCGGATCC
Reverse primer AATTCCCCTCTAGA
Product length 154

Actually the primers were designed earlier by my labmate, and while checking i saw the complementarity of the forward primer with the plasmid. But i couldn see the complementarity of the reverse primer, so only i proceeded with the PCR.

The secret to finding your reverse primer in your sequence: http://www.bioinformatics.org/sms/rev_comp.html