Length of non-binding sequence in primers with RE site - (Oct/27/2011 )

I have a primer which has 4 nt overhang sequence, 6 nt RE sequence and a TATAGGG sequence just before the binding sequence of the gene of interest:

CAGA CGTCTC G TATAGGG ACCAAACAGAGAATCTGTGAG
--------------------------------------

so the non-binding sequence is 18 nucleotides, compared to the 21 nucleotide binding sequence.

Will this PCR work? how long the non-binding sequence can be to not affect the binding ability of the binding sequence?

-Curtis-

I've been running PCR with Primers that had 26 binding-nt and 27 non-binding nt. And it worked well. However I had 10 nt at 5' and 16 nt at 3' end that matched which means the non-binding part was like a loop inbetween.

But I think you can try and run the PCR. I guess it might depend on the annealing temperature of the primer part that binds.

-Papaver-

There's no reason to think this should not work. Are you having trouble?

-phage434-

yes phage434, actually I am. however the Tm between my primers is also above 5C, so I'm not sure if the problem is because of the Tm difference or the Forward primer's non-binding site.

-Curtis-

What is your second primer? What are your cycling conditions and reaction mix?

-phage434-

phage434 on Sat Oct 29 16:50:15 2011 said:

What is your second primer? What are your cycling conditions and reaction mix?

I'm still dealing with the same full-length assembly of a virus genome. I hope you remember my older posts that you also replied to them.
here's the link

http://www.protocol-online.org/forums/topic/22836-tm-calculation-for-primers-with-re-sites-and-overhangs/page__fromsearch__1

I have got PCRs to work with primers with higher than 5C Tm difference, but this one is really annoying me.

-Curtis-

Have you tried a gradient PCR for optimizing your annealing temperature. In the other post you wrote you use Pfu with extension time 2kb/min. Is it really that high. Whenever I used Pfu I run 30sec/min. Maybe another polymerase would be better. Phusion is a good one...
Is your template good and does it differ from you usual PCR stuff? Do you run a positive control to be sure that general conditions are ok?

-Papaver-