PCR product wrong size! Need help! - (Dec/13/2010 )

I've got a sequence, ~1.5kb:
5' ATAGTCTAGTTCTGACCATCAGTATTCAAAGCTGCAACCATGTTGCTTTTCCTGCTGTTGTCGGTGGTCACGTTGACCTATTTCTGGATTGGAAGG
--------TGTTATGATAGCGAAGGTAGCATTGATTCTACTCTTGTCGAAGTACAACTTTAAGGCAACACAAGATTCAAAAATGGTGTTCAGTTCAGCGTCGGTGCCGCTTTTACCAAAACATGGAGTGTTACTGAAAATTTCCAAAAGAAAATAAAAGTATTTTTATTTCCGAAAAAAAAA 3'

I want to conduct a pcr to amplify this fragment and the product must include both the ATG and TAA. However, i was not able to design a suitable one using primer3plus... mostly due to the 3' end which contains high AT and dimers. The only possible pair that i've designed after checking with NetPrimer for dimer and blast for specificity, however, produce fragment of only ~750 bp. I've tried different Ta from 46-54C (Tm=55 and 56C). Ta
54C>> no band
52C>> no band
51C>> 1 smear 100
50C>> 1 distinct band ~750bp (2.5U polymerase); 3 bands for 1.25U: 750 (distinct), 100(smear), 1500 (faint)
49C>> 1 band 750, 1 smear 100
48C>> multiple faint bands
46C>> multiple faint bands
All rxn in 25 ul mixture, 1.25U polymerase
What should i do for this situation? I've spent 2 days to try to design another set of primers, but it seems impossible...

Have you tried secondary structure inhibitors such as DMSO and/or betaine?

hianghao on Mon Dec 13 13:55:51 2010 said:

Here, you could try giving the polymerase more time for extension....so that the 1.5kb faint band gets better. you must try diff. concentrations of Mg and like Bob said, something like betaine.

I think DMSO works better when you have GC rich DNA, but in your case you have AT rich DNA, so I would go for betaine.

gt_ameya on Tue Dec 14 05:41:42 2010 said:

I'll try to find betaine. My extension time was 5m and final extension was 10m. Thanks for the advises!

hianghao on Tue Dec 14 08:47:49 2010 said:

I can't find any betaine in my lab, but probably DMSO in neighbour labs. How much DMSO should i use for a reaction? I searched in the archives and found threads discussing bout AT rich template pcr using extension of ~60-65C. I am not sure whether my template is AT rich. I can only say that the 3' end is AT rich. Should i try extension of 60C?

I use 1 ul of DMSO per 20 ul reaction - works out to be about 6 M if I recall correctly.

I wouldn't bother with the lower extension temperature. How similar are the calculated primer annealing temperatures?

bob1 on Wed Dec 15 00:55:28 2010 said:

I don't really get what u mean by calculated Ta. Tm of both primers were 55.3 and 54.3C. Polymerase = Pfu
95C 1m
95C 30s ---
50c 30s | 35cycles
72C 5m ---
72C 10m

hianghao on Wed Dec 15 03:02:51 2010 said:

Is there any particular reason that your annealing and denaturation times are so less as compared to extension time? I dont quite remember what role annealing time plays, but would suggest increasing both denaturation and annealing temperatures by atleast 15 secs.

hianghao on Wed Dec 15 03:02:51 2010 said:

Calculated Ta is your melting temp. minus five degrees. So ideally your Ta should be 49oC and since you are not getting any product there... you should go lower 45-48oC and make your extension stringent to get a single band of your interest

gt_ameya on Wed Dec 15 07:51:52 2010 said:

There is no particular reason why my denaturation and annealing were low. Before dealing with this sample with this set of primers, i use another set of primers for another sample and it worked well. So i didn't bother with the setting. Besides that, because i read that Pfu require 2m ext time per kb, and my fragment is ~1.5kb, so i put it longer. I've tried lower Ta but got smear. The best Ta was 50C, but wrong size.

I've tried DMSO, the bands improved but still the size was 750bp not 1500bp